mirror of
				https://gitee.com/coder-xiaomo/leetcode-problemset
				synced 2025-11-04 11:43:12 +08:00 
			
		
		
		
	
		
			
				
	
	
		
			26 lines
		
	
	
		
			1.2 KiB
		
	
	
	
		
			HTML
		
	
	
	
	
	
			
		
		
	
	
			26 lines
		
	
	
		
			1.2 KiB
		
	
	
	
		
			HTML
		
	
	
	
	
	
<p>The <strong>DNA sequence</strong> is composed of a series of nucleotides abbreviated as <code>'A'</code>, <code>'C'</code>, <code>'G'</code>, and <code>'T'</code>.</p>
 | 
						|
 | 
						|
<ul>
 | 
						|
	<li>For example, <code>"ACGAATTCCG"</code> is a <strong>DNA sequence</strong>.</li>
 | 
						|
</ul>
 | 
						|
 | 
						|
<p>When studying <strong>DNA</strong>, it is useful to identify repeated sequences within the DNA.</p>
 | 
						|
 | 
						|
<p>Given a string <code>s</code> that represents a <strong>DNA sequence</strong>, return all the <strong><code>10</code>-letter-long</strong> sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in <strong>any order</strong>.</p>
 | 
						|
 | 
						|
<p> </p>
 | 
						|
<p><strong>Example 1:</strong></p>
 | 
						|
<pre><strong>Input:</strong> s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
 | 
						|
<strong>Output:</strong> ["AAAAACCCCC","CCCCCAAAAA"]
 | 
						|
</pre><p><strong>Example 2:</strong></p>
 | 
						|
<pre><strong>Input:</strong> s = "AAAAAAAAAAAAA"
 | 
						|
<strong>Output:</strong> ["AAAAAAAAAA"]
 | 
						|
</pre>
 | 
						|
<p> </p>
 | 
						|
<p><strong>Constraints:</strong></p>
 | 
						|
 | 
						|
<ul>
 | 
						|
	<li><code>1 <= s.length <= 10<sup>5</sup></code></li>
 | 
						|
	<li><code>s[i]</code> is either <code>'A'</code>, <code>'C'</code>, <code>'G'</code>, or <code>'T'</code>.</li>
 | 
						|
</ul>
 |