1
0
mirror of https://gitee.com/coder-xiaomo/leetcode-problemset synced 2025-10-25 23:08:57 +08:00
Code Issues Projects Releases Wiki Activity GitHub Gitee
Files
leetcode-problemset/leetcode-cn/problem (English)/重复的DNA序列(English) [repeated-dna-sequences].html
2022-03-29 12:43:11 +08:00

26 lines
1.2 KiB
HTML

<p>The <strong>DNA sequence</strong> is composed of a series of nucleotides abbreviated as <code>&#39;A&#39;</code>, <code>&#39;C&#39;</code>, <code>&#39;G&#39;</code>, and <code>&#39;T&#39;</code>.</p>
<ul>
<li>For example, <code>&quot;ACGAATTCCG&quot;</code> is a <strong>DNA sequence</strong>.</li>
</ul>
<p>When studying <strong>DNA</strong>, it is useful to identify repeated sequences within the DNA.</p>
<p>Given a string <code>s</code> that represents a <strong>DNA sequence</strong>, return all the <strong><code>10</code>-letter-long</strong> sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in <strong>any order</strong>.</p>
<p>&nbsp;</p>
<p><strong>Example 1:</strong></p>
<pre><strong>Input:</strong> s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
<strong>Output:</strong> ["AAAAACCCCC","CCCCCAAAAA"]
</pre><p><strong>Example 2:</strong></p>
<pre><strong>Input:</strong> s = "AAAAAAAAAAAAA"
<strong>Output:</strong> ["AAAAAAAAAA"]
</pre>
<p>&nbsp;</p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 &lt;= s.length &lt;= 10<sup>5</sup></code></li>
<li><code>s[i]</code> is either <code>&#39;A&#39;</code>, <code>&#39;C&#39;</code>, <code>&#39;G&#39;</code>, or <code>&#39;T&#39;</code>.</li>
</ul>