{ "data": { "question": { "questionId": "187", "questionFrontendId": "187", "boundTopicId": null, "title": "Repeated DNA Sequences", "titleSlug": "repeated-dna-sequences", "content": "

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.

\n\n\n\n

When studying DNA, it is useful to identify repeated sequences within the DNA.

\n\n

Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

\n\n

 

\n

Example 1:

\n
Input: s = \"AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT\"\nOutput: [\"AAAAACCCCC\",\"CCCCCAAAAA\"]\n

Example 2:

\n
Input: s = \"AAAAAAAAAAAAA\"\nOutput: [\"AAAAAAAAAA\"]\n
\n

 

\n

Constraints:

\n\n\n", "translatedTitle": null, "translatedContent": null, "isPaidOnly": false, "difficulty": "Medium", "likes": 3189, "dislikes": 506, "isLiked": null, "similarQuestions": "[]", "exampleTestcases": "\"AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT\"\n\"AAAAAAAAAAAAA\"", "categoryTitle": "Algorithms", "contributors": [], "topicTags": [ { "name": "Hash Table", "slug": "hash-table", "translatedName": null, "__typename": "TopicTagNode" }, { "name": "String", "slug": "string", "translatedName": null, "__typename": "TopicTagNode" }, { "name": "Bit Manipulation", "slug": "bit-manipulation", "translatedName": null, "__typename": "TopicTagNode" }, { "name": "Sliding Window", "slug": "sliding-window", "translatedName": null, "__typename": "TopicTagNode" }, { "name": "Rolling Hash", "slug": "rolling-hash", "translatedName": null, "__typename": "TopicTagNode" }, { "name": "Hash Function", "slug": "hash-function", "translatedName": null, "__typename": "TopicTagNode" } ], "companyTagStats": null, "codeSnippets": [ { "lang": "C++", "langSlug": "cpp", "code": "class Solution {\npublic:\n vector findRepeatedDnaSequences(string s) {\n \n }\n};", "__typename": "CodeSnippetNode" }, { "lang": "Java", "langSlug": "java", "code": "class Solution {\n public List findRepeatedDnaSequences(String s) {\n \n }\n}", "__typename": "CodeSnippetNode" }, { "lang": "Python", "langSlug": "python", "code": "class Solution(object):\n def findRepeatedDnaSequences(self, s):\n \"\"\"\n :type s: str\n :rtype: List[str]\n \"\"\"\n ", "__typename": "CodeSnippetNode" }, { "lang": "Python3", "langSlug": "python3", "code": "class Solution:\n def findRepeatedDnaSequences(self, s: str) -> List[str]:\n ", "__typename": "CodeSnippetNode" }, { "lang": "C", "langSlug": "c", "code": "/**\n * Note: The returned array must be malloced, assume caller calls free().\n */\nchar** findRepeatedDnaSequences(char* s, int* returnSize) {\n \n}", "__typename": "CodeSnippetNode" }, { "lang": "C#", "langSlug": "csharp", "code": "public class Solution {\n public IList FindRepeatedDnaSequences(string s) {\n \n }\n}", "__typename": "CodeSnippetNode" }, { "lang": "JavaScript", "langSlug": "javascript", "code": "/**\n * @param {string} s\n * @return {string[]}\n */\nvar findRepeatedDnaSequences = function(s) {\n \n};", "__typename": "CodeSnippetNode" }, { "lang": "TypeScript", "langSlug": "typescript", "code": "function findRepeatedDnaSequences(s: string): string[] {\n \n};", "__typename": "CodeSnippetNode" }, { "lang": "PHP", "langSlug": "php", "code": "class Solution {\n\n /**\n * @param String $s\n * @return String[]\n */\n function findRepeatedDnaSequences($s) {\n \n }\n}", "__typename": "CodeSnippetNode" }, { "lang": "Swift", "langSlug": "swift", "code": "class Solution {\n func findRepeatedDnaSequences(_ s: String) -> [String] {\n \n }\n}", "__typename": "CodeSnippetNode" }, { "lang": "Kotlin", "langSlug": "kotlin", "code": "class Solution {\n fun findRepeatedDnaSequences(s: String): List {\n \n }\n}", "__typename": "CodeSnippetNode" }, { "lang": "Dart", "langSlug": "dart", "code": "class Solution {\n List findRepeatedDnaSequences(String s) {\n \n }\n}", "__typename": "CodeSnippetNode" }, { "lang": "Go", "langSlug": "golang", "code": "func findRepeatedDnaSequences(s string) []string {\n \n}", "__typename": "CodeSnippetNode" }, { "lang": "Ruby", "langSlug": "ruby", "code": "# @param {String} s\n# @return {String[]}\ndef find_repeated_dna_sequences(s)\n \nend", "__typename": "CodeSnippetNode" }, { "lang": "Scala", "langSlug": "scala", "code": "object Solution {\n def findRepeatedDnaSequences(s: String): List[String] = {\n \n }\n}", "__typename": "CodeSnippetNode" }, { "lang": "Rust", "langSlug": "rust", "code": "impl Solution {\n pub fn find_repeated_dna_sequences(s: String) -> Vec {\n \n }\n}", "__typename": "CodeSnippetNode" }, { "lang": "Racket", "langSlug": "racket", "code": "(define/contract (find-repeated-dna-sequences s)\n (-> string? (listof string?))\n )", "__typename": "CodeSnippetNode" }, { "lang": "Erlang", "langSlug": "erlang", "code": "-spec find_repeated_dna_sequences(S :: unicode:unicode_binary()) -> [unicode:unicode_binary()].\nfind_repeated_dna_sequences(S) ->\n .", "__typename": "CodeSnippetNode" }, { "lang": "Elixir", "langSlug": "elixir", "code": "defmodule Solution do\n @spec find_repeated_dna_sequences(s :: String.t) :: [String.t]\n def find_repeated_dna_sequences(s) do\n \n end\nend", "__typename": "CodeSnippetNode" } ], "stats": "{\"totalAccepted\": \"352.6K\", \"totalSubmission\": \"733.3K\", \"totalAcceptedRaw\": 352650, \"totalSubmissionRaw\": 733252, \"acRate\": \"48.1%\"}", "hints": [], "solution": { "id": "769", "canSeeDetail": false, "paidOnly": true, "hasVideoSolution": false, "paidOnlyVideo": true, "__typename": "ArticleNode" }, "status": null, "sampleTestCase": "\"AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT\"", "metaData": "{\r\n \"name\": \"findRepeatedDnaSequences\",\r\n \"params\": [\r\n {\r\n \"name\": \"s\",\r\n \"type\": \"string\"\r\n }\r\n ],\r\n \"return\": {\r\n \"type\": \"list\"\r\n }\r\n}", "judgerAvailable": true, "judgeType": "large", "mysqlSchemas": [], "enableRunCode": true, "enableTestMode": false, "enableDebugger": true, "envInfo": "{\"cpp\": [\"C++\", \"

Compiled with clang 11 using the latest C++ 20 standard.

\\r\\n\\r\\n

Your code is compiled with level two optimization (-O2). AddressSanitizer is also enabled to help detect out-of-bounds and use-after-free bugs.

\\r\\n\\r\\n

Most standard library headers are already included automatically for your convenience.

\"], \"java\": [\"Java\", \"

OpenJDK 17. Java 8 features such as lambda expressions and stream API can be used.

\\r\\n\\r\\n

Most standard library headers are already included automatically for your convenience.

\\r\\n

Includes Pair class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.

\"], \"python\": [\"Python\", \"

Python 2.7.12.

\\r\\n\\r\\n

Most libraries are already imported automatically for your convenience, such as array, bisect, collections. If you need more libraries, you can import it yourself.

\\r\\n\\r\\n

For Map/TreeMap data structure, you may use sortedcontainers library.

\\r\\n\\r\\n

Note that Python 2.7 will not be maintained past 2020. For the latest Python, please choose Python3 instead.

\"], \"c\": [\"C\", \"

Compiled with gcc 8.2 using the gnu11 standard.

\\r\\n\\r\\n

Your code is compiled with level one optimization (-O1). AddressSanitizer is also enabled to help detect out-of-bounds and use-after-free bugs.

\\r\\n\\r\\n

Most standard library headers are already included automatically for your convenience.

\\r\\n\\r\\n

For hash table operations, you may use uthash. \\\"uthash.h\\\" is included by default. Below are some examples:

\\r\\n\\r\\n

1. Adding an item to a hash.\\r\\n

\\r\\nstruct hash_entry {\\r\\n    int id;            /* we'll use this field as the key */\\r\\n    char name[10];\\r\\n    UT_hash_handle hh; /* makes this structure hashable */\\r\\n};\\r\\n\\r\\nstruct hash_entry *users = NULL;\\r\\n\\r\\nvoid add_user(struct hash_entry *s) {\\r\\n    HASH_ADD_INT(users, id, s);\\r\\n}\\r\\n
\\r\\n

\\r\\n\\r\\n

2. Looking up an item in a hash:\\r\\n

\\r\\nstruct hash_entry *find_user(int user_id) {\\r\\n    struct hash_entry *s;\\r\\n    HASH_FIND_INT(users, &user_id, s);\\r\\n    return s;\\r\\n}\\r\\n
\\r\\n

\\r\\n\\r\\n

3. Deleting an item in a hash:\\r\\n

\\r\\nvoid delete_user(struct hash_entry *user) {\\r\\n    HASH_DEL(users, user);  \\r\\n}\\r\\n
\\r\\n

\"], \"csharp\": [\"C#\", \"

C# 10 with .NET 6 runtime

\"], \"javascript\": [\"JavaScript\", \"

Node.js 16.13.2.

\\r\\n\\r\\n

Your code is run with --harmony flag, enabling new ES6 features.

\\r\\n\\r\\n

lodash.js library is included by default.

\\r\\n\\r\\n

For Priority Queue / Queue data structures, you may use 5.3.0 version of datastructures-js/priority-queue and 4.2.1 version of datastructures-js/queue.

\"], \"ruby\": [\"Ruby\", \"

Ruby 3.1

\\r\\n\\r\\n

Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms

\"], \"swift\": [\"Swift\", \"

Swift 5.5.2.

\"], \"golang\": [\"Go\", \"

Go 1.21

\\r\\n

Support https://godoc.org/github.com/emirpasic/gods@v1.18.1 library.

\"], \"python3\": [\"Python3\", \"

Python 3.10.

\\r\\n\\r\\n

Most libraries are already imported automatically for your convenience, such as array, bisect, collections. If you need more libraries, you can import it yourself.

\\r\\n\\r\\n

For Map/TreeMap data structure, you may use sortedcontainers library.

\"], \"scala\": [\"Scala\", \"

Scala 2.13.7.

\"], \"kotlin\": [\"Kotlin\", \"

Kotlin 1.9.0.

\"], \"rust\": [\"Rust\", \"

Rust 1.58.1

\\r\\n\\r\\n

Supports rand v0.6\\u00a0from crates.io

\"], \"php\": [\"PHP\", \"

PHP 8.1.

\\r\\n

With bcmath module

\"], \"typescript\": [\"Typescript\", \"

TypeScript 5.1.6, Node.js 16.13.2.

\\r\\n\\r\\n

Your code is run with --harmony flag, enabling new ES2022 features.

\\r\\n\\r\\n

lodash.js library is included by default.

\"], \"racket\": [\"Racket\", \"

Run with Racket 8.3.

\"], \"erlang\": [\"Erlang\", \"Erlang/OTP 25.0\"], \"elixir\": [\"Elixir\", \"Elixir 1.13.4 with Erlang/OTP 25.0\"], \"dart\": [\"Dart\", \"

Dart 2.17.3

\\r\\n\\r\\n

Your code will be run directly without compiling

\"]}", "libraryUrl": null, "adminUrl": null, "challengeQuestion": null, "__typename": "QuestionNode" } } }