{ "data": { "question": { "questionId": "187", "questionFrontendId": "187", "boundTopicId": null, "title": "Repeated DNA Sequences", "titleSlug": "repeated-dna-sequences", "content": "
The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.
"ACGAATTCCG" is a DNA sequence.When studying DNA, it is useful to identify repeated sequences within the DNA.
\n\nGiven a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.
\n
Example 1:
\nInput: s = \"AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT\"\nOutput: [\"AAAAACCCCC\",\"CCCCCAAAAA\"]\n
Example 2:
\nInput: s = \"AAAAAAAAAAAAA\"\nOutput: [\"AAAAAAAAAA\"]\n\n
\n
Constraints:
\n\n1 <= s.length <= 105s[i] is either 'A', 'C', 'G', or 'T'.Compiled with clang 11 using the latest C++ 17 standard.
Your code is compiled with level two optimization (-O2). AddressSanitizer is also enabled to help detect out-of-bounds and use-after-free bugs.
Most standard library headers are already included automatically for your convenience.
\"], \"java\": [\"Java\", \" OpenJDK 17 . Java 8 features such as lambda expressions and stream API can be used.
Most standard library headers are already included automatically for your convenience.
\\r\\nIncludes Pair class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.
Python 2.7.12.
Most libraries are already imported automatically for your convenience, such as array, bisect, collections. If you need more libraries, you can import it yourself.
\\r\\n\\r\\nFor Map/TreeMap data structure, you may use sortedcontainers library.
\\r\\n\\r\\nNote that Python 2.7 will not be maintained past 2020. For the latest Python, please choose Python3 instead.
\"], \"c\": [\"C\", \"Compiled with gcc 8.2 using the gnu99 standard.
Your code is compiled with level one optimization (-O1). AddressSanitizer is also enabled to help detect out-of-bounds and use-after-free bugs.
Most standard library headers are already included automatically for your convenience.
\\r\\n\\r\\nFor hash table operations, you may use uthash. \\\"uthash.h\\\" is included by default. Below are some examples:
\\r\\n\\r\\n1. Adding an item to a hash.\\r\\n
\\r\\nstruct hash_entry {\\r\\n int id; /* we'll use this field as the key */\\r\\n char name[10];\\r\\n UT_hash_handle hh; /* makes this structure hashable */\\r\\n};\\r\\n\\r\\nstruct hash_entry *users = NULL;\\r\\n\\r\\nvoid add_user(struct hash_entry *s) {\\r\\n HASH_ADD_INT(users, id, s);\\r\\n}\\r\\n\\r\\n\\r\\n\\r\\n2. Looking up an item in a hash:\\r\\n
\\r\\nstruct hash_entry *find_user(int user_id) {\\r\\n struct hash_entry *s;\\r\\n HASH_FIND_INT(users, &user_id, s);\\r\\n return s;\\r\\n}\\r\\n\\r\\n\\r\\n\\r\\n3. Deleting an item in a hash:\\r\\n
\\r\\nvoid delete_user(struct hash_entry *user) {\\r\\n HASH_DEL(users, user); \\r\\n}\\r\\n\\r\\n\"], \"csharp\": [\"C#\", \"\\r\\n\\r\\nYour code is compiled with debug flag enabled (/debug).
Node.js 16.13.2.
Your code is run with --harmony flag, enabling new ES6 features.
lodash.js library is included by default.
\\r\\n\\r\\nFor Priority Queue / Queue data structures, you may use datastructures-js/priority-queue and datastructures-js/queue.
\"], \"ruby\": [\"Ruby\", \"Ruby 3.1
Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms
\"], \"swift\": [\"Swift\", \"Swift 5.5.2.
Go 1.17.6.
Support https://godoc.org/github.com/emirpasic/gods library.
\"], \"python3\": [\"Python3\", \"Python 3.10.
Most libraries are already imported automatically for your convenience, such as array, bisect, collections. If you need more libraries, you can import it yourself.
\\r\\n\\r\\nFor Map/TreeMap data structure, you may use sortedcontainers library.
\"], \"scala\": [\"Scala\", \"Scala 2.13.7.
Kotlin 1.3.10.
Rust 1.58.1
Supports rand v0.6\\u00a0from crates.io
\"], \"php\": [\"PHP\", \"PHP 8.1.
With bcmath module
\"], \"typescript\": [\"Typescript\", \"TypeScript 4.5.4, Node.js 16.13.2.
Your code is run with --harmony flag, enabling new ES2020 features.
lodash.js library is included by default.
\"], \"racket\": [\"Racket\", \"Run with Racket 8.3.